
Marker Information
Marker name | AHGS1860 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | AAAGCAAGGTTTGCACCATC | |
Rv | ATTCCTATCTGCATGCACCG | ||
EST/Genome sequences | KICT14C23 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | SKF2 | Linkage | LG01.2 |
Position | 14.392 | ||
BF6 | Linkage | BB04 | |
Position | 22.727 | ||
TF6 | Linkage | TA03 | |
Position | 52.229 | ||
TF6 | Linkage | TB01 | |
Position | 35.871 | ||
Integrated consensus map | Linkage | A03 | |
Position | 90.373 | ||
Integrated consensus map | Linkage | B01 | |
Position | 32.198 | ||
Integrated consensus map | Linkage | B04 | |
Position | 71.285 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 237 | |
Pattern* | AG | ||
Repeat count | 19 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.