
Marker Information
Marker name | AHGS1278 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GGAGCAGAATTCAGTTCATTTACA | |
Rv | ACTGGAGCCTATTCTTCGCA | ||
EST/Genome sequences | KICT06A21 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | NYF2 | Linkage | LG02.1 |
Position | 66.644 | ||
AF5 | Linkage | AA03 | |
Position | 29.911 | ||
TF6 | Linkage | TA03 | |
Position | 56.281 | ||
TF6 | Linkage | TB02 | |
Position | 63.439 | ||
Integrated consensus map | Linkage | A03 | |
Position | 94.364 | ||
Integrated consensus map | Linkage | B02 | |
Position | 87.666 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 297 | |
Pattern* | AG | ||
Repeat count | 29 | ||
Method | PCR | ||
Detection | |||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | Shirasawa et al. (2012) |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.