
Marker Information
Marker name | HES01637_a | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CGCCAAATCAAGACTTGTGA | |
Rv | AACTTCCCCCACCAATGTTT | ||
EST/Genome sequences | 115-ES-CLC110705contig17541DeNovoAssembly | ||
Lines | 4 | ||
PIC | Value | ||
Lines | |||
Linkage Map | D36 | Linkage | LGD03 |
Position | 13.849 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 123 | |
Pattern* | GGC | ||
Repeat count | 5 | ||
Method | PCR | 55 | |
Detection | 10% PAGE | ||
Multiplex | |||
Gel image | HES01637_01664.jpg | ||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.