
Marker Information
Marker name | RSS0977 | ||
---|---|---|---|
Marker category | EST-SSR | ||
Primer sequences | Fw | CATCCCAAGGCCTAAGATGA | |
Rv | AGAAGCAAGGAAAGCATGGA | ||
EST/Genome sequences | RSCS11D14 (Other Page) | ||
Lines | |||
PIC | Value | ||
Lines | |||
Linkage Map | GHRI | Linkage | LG8 |
Position | 64.4 | ||
SNP | Position | ||
Method | |||
SSR | Fragment size | 169 | |
Pattern* | AAG(mis2) | ||
Repeat count | 5 | ||
Method | PCR | 60 | |
Detection | PAGE | ||
Multiplex | |||
Gel image | |||
Enzyme | |||
Related markers | Marker name | ||
Species | |||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.