Tomato Marker Database

original sequence
>SL_EcoRI0039O20_T7_296880 SL_EcoRI0039O20_T7_296880 Chromat_file:SL_EcoRI_039_O20-T7 SGN_GSS_ID:313706 (vector and quality trimmed)
TTGGTATGAAATTTTACAAGGGATGTAGACTAACCTACCGTAGAATGCAAGATGATTACA
AACTTGAATAACACAAGGAATATAAATAATGTGGTGTGAGTATGTTTGATAGACTCTTCA
CTTACCCCACTTATCTTACAAATTAAAATTGAAAGGTTATTAGACTCTTCATTATCTACA
TTTAATTAGTACATGAATATATGTAGTACATGAATATATGATGCATTAAGATCTTATTTG
ATGCATGAATTTAAATATAACTTTTACTTAATATTTAATTAATTAAATAGATATTAATTT
ATTTTAGAGGTAAAATAAGGGTAAAATGGTAATTCAACTTTGAGGTTAGGAGCTTCCACT
TATAATAATACTAGTTTCCGGGCACGCGCTTTGCGCGTGTAACCCATGAATGTATTATTT
CTTACAAGATAATACTATTAAATAATAAAATATGTCTAATTAAGATTTCTTACTTTGTTT
TACTACTAATTGTGACACTCCAATTTTCTAACCTTCAAGTGAATGCATCGAGATAATAAT
ATGAGAAATTAATAAAATAAACTTTGTTTGTAATTCAAAAAATAAGTTTGTAAAGCTAAG
AGGAAAAATAACAACTATCTAAATTAAATTTCTTGATAGTTCCGTTTTATTGGTAGAATA
ATGCTAGATAG


MarkerDB | Solanum lycopersicum