Tomato Marker Database

original sequence
>LE_HBa0010B14_T7_4683 LE_HBa0010B14_T7_4683 Chromat_file:LE_HBa_010_B14-T7 SGN_GSS_ID:4683 (vector and quality trimmed)
AGCTTGTGTGGGGAGATATACCATATCGGTTAAAGGAAAAGAAAGTGCAAAGCTACAAAA
CAAAGAAGCCATAGGAGGGACTCNAAATGCAACNCTCCAGTTCATCATAACACAGAGGGA
TAATAGTTTTCTAATCACACCTTTATTACGACAAAATAACCCTAACTTATATAAAATGGC
TGCAACCAACCAAAGGAAAGGTTAAACAGTTTTATTGCAAACCACTTGATCAAAAAGCCC
TACTCACCCGCCACCCACNCCCCAACACCACCNCTCTCCCCACCCCCCAAAACATAAGAT
TTCTTTCTTTCTTCTGTCATACTAGTGCAGAAAAACAAACCAAAATCCATAGTGTGATAC
AAGCCTATCTCAACAACGAAAGTTGCCCAATGTTTGAGACAAGCCATTTTTCACTCGCAA
TTTTGCCTAACGTTCTTCAAAGACATTAATATGGCACTTCTCCAACCNTCCTTCTAGTGC
CAGGGAAAACGGGGAGGATGTTTTTTGCCTCCTTATCAATGTTGTCATGCCAAAAAAGAA
ATATCCTAACAAACAATCATGCAATTAAAATAACAAACAAATTAGTTGCTTGAGATAGTT
GGAATTTCCTTTTTGATTTGAAATGTGGCACTATGAAATCAAAACACATGTTCAGTCCAA
TACACCAAAGAATGATTTAAAAAATGAGCAATTCCAGCAAACAGAAAAGTCACCTNCCAA
TCAAGTCATATGTGCATTCGAATGCTGACGAGTACTC


MarkerDB | Solanum lycopersicum