Tomato Marker Database

original sequence
>LE_HBa0111H17_SP6_36080 LE_HBa0111H17_SP6_36080 Chromat_file:LE_HBa_111_H17-SP6 SGN_GSS_ID:36080 (vector and quality trimmed)
CAAACCTATGAATATGGTTAGTGAAAAGTTTTAATAATGAAACTCAATAAGGTATATATT
TATTTCAATTTGATGAGGTTAATCATGTAACTAGTCTTATCACTAATATTACCTTAAAAA
CAATATTTTCTTTGTATTTTTCTTTTCATCTAACCAAATATGATTTGCATGTGTATTTCA
AGTTAAATTGTTTAAATATCATATGAATACGTGAAAAGAACATGTACATTTTATATATTC
AAATATTTTATCATTGGTTGTGAGTTTTTTTTTTAAATAACTTAGAATTTTTTAAAATAA
TATATTTTGAAGATAAAAACTCTTGTTAACTTGATAATACATTTGTGACACATATAATAC
TTTGATTTAAATACAAATACCTGTCCAAATATAAATATATATTTGAATTAATAAAAATTT
TGATCTCATAAAATTAACTATTGAATAAATAAAATAATAAAATATTACGAGCTTCAACTT
GTGTTATT


MarkerDB | Solanum lycopersicum