Tomato Marker Database

original sequence
>SL_EcoRI0114A09_SP6_322180 SL_EcoRI0114A09_SP6_322180 Chromat_file:SL_EcoRI_114_A09-SP6 SGN_GSS_ID:339006 (vector and quality trimmed)
CTTGTGTTTATCGCTGATCATCAGAGAATTTGATTAGCAAAACGTGTTTGGAATGGTTGG
TAATCCGGTGGATGAGCATTTTCGACCTCCAGATCCACCGTTAGGAGAGGAGGTATCGAA
TGTTCAATCGAAAATGAATGAAATGGCGGACGGAGCATCATCTTCCTCTTCGCACTTGAG
GGAAGAAGCGATCCAAGTCGCGACTATAGAGGCGGAGATGGATGAGTTTCGTCATCATCG
CGAAATAGATCGAAATCTGACTTCACAGGTTGTCGACATACAAATGGCGGATAATTTGCA
ACAATTGGTAACTGGTGTGTCACAAAGGAGAGGGGTGGAGAACGTACAGGCGATTGGAAC
AGAGAAATTGAGTTCGATGGAGGCGGCGATAGAAATTGCATCGGAGAAGTCGAGTTCGAT
GGAGGCGGGGCAATCCAGTTCTAGGGTTAATCGAACGGATAATTCGCAACAAAAATCAAT
TACTGATGGTATTCAACCACCTGTGAATTACGATGGTCAAAAGGGTATTCAATCGACTCA
AATTCAACAACGAACTGATAATTCTCACAAGAATTCAGAAATATATCAACAACAACAACA
AATTGATTCTACAAATATAAGAAACACAAATTCGAGAACAACAGCTATTCAGCAGACCCA
AAATAGGCAAAATATTGGGAGTTCTTCTGAGCTACTGGATCAAGGTAACATTACTATTCA
TACTACCCATTATGATGTGCAAGAAATTGGTAGATTGAATGTAGAATCCGTTA


MarkerDB | Solanum lycopersicum