Tomato Marker Database

original sequence
>LE_HBa0216N23_T7_391580 LE_HBa0216N23_T7_391580 Chromat_file:LE_HBa_216_N23-T7 SGN_GSS_ID:408774 (vector and quality trimmed)
AAGCTTGGTCGCTATTAATTCCGACCTTTGGAGGTCAGTATTTACTAACTAGCGGAGGTC
AATTTTAATTTATGTCGATAAAATTTTTTATTTATTTTTTGACTTCCGGAGGTTAGTTTA
ATATATTTGTTTATTTTTTATTTTTATTATTTCTATCTTCTAGAGGTCAAAATTTTTAAT
TATCAAATTTTTGAATACCGACCTCCAAAAGTCGGTATTTTTATTTCCTATTTTTTAGAT
TCTGACCTCTGGAGGTTGGTATTTTCATTTCTTATTTTTTTGATTTCAACCTCTGGAGGT
TGGTTTCTATTTCTTATTTTTTAGATTCCAACCTCCGGAGATCGGTATTTCTATTTCTTA
TTCTTTAGATTTCGACTTCTGGAGGTCTGTATTTATATTTCCTATTTTTTAGATTCTGAT
CTTCAGAGGTCGGTATTTTTATTTCTTATTTTTGAGATTCCGACCTCCAGAGGTCGGTAT
TTGTATTTCTTATTTTTGAGATTCTGACCTCCGGAGGTCAGTATCTCTATTTCTTATTAT
TTAGATTCCGATCCTCGGAGGTCAGTATTTTTATTTTCTTATTTTTTAGATTCTAACCTT
CGCAGGTCGGTATTTCCATTTCTTACTTTTTAGATTTCGACCTCCGGAGGTCGGTATTTC
TACTACAAATATGGCAACAGCTGCAATTTGAGTATCCCACCTGTATATTTATATAAAAAT
AACCCAGATAATTTCAAATAAGCTA


MarkerDB | Solanum lycopersicum