Tomato Marker Database

original sequence
>LE_HBa0213G09_SP6_374308 LE_HBa0213G09_SP6_374308 Chromat_file:LE_HBa_213_G09-SP6 SGN_GSS_ID:391519 (vector and quality trimmed)
ACACAGGGGCTTATCCGTCTCAGGCAAAGTTCCACTGGTTTTGGACCATAGCTCTTGGGC
TCCCCCTTCAACTTCGGTCGGCAAAAGTAATGAAGAAATAGGGGACCAGTGTGGTAGCTG
GTTAGAGACAGAAGAAGAAACGCTTCTCAAGAATCATATGAGATGGGCTCGTATCAAAGT
GAAGGGACCTCTCGAGCAAATACCACGCTTCGTAGAGATCGCCAATGGTAACATAGTGTT
CTCGTTACTGATCTGGGTAGAAGCTCCGGCGAGATACAGAATGGTCAACAAGTGCAGGCG
CGACCATCAAGATGAGAGTGACAAGAGCCGAAATAAGGTAGACAATCTGTTTACCTCCTT
AAAAGAAAAAGAAACAGAGCACGAAAGAGGAAAAAGGACTGGAAAATATCTGATGGATAT
TGAGGAGGTGGAGGTGGAAGACACACGGGATAGAAGCAGGGATGTGTAACGGAAAAGCAG
AAAGAAGTAAGAATAATTCAGTGCGTGGAAAGACAGATTGTTCAAGGGGAAATGAACATA
GTTGGAAGTAGGTCCATGGAAATTGAACCCTGGGAAGGAGAAGAAACACAGGAAAGTAAC
CCTAAGCAGATGATGCATTACAATGGAATAGAGCCATTACAAGTGGACGAGTCGATCAGT
GAGGAAGAACCGAAGGAGAAAGCTACATTGTGGATG


MarkerDB | Solanum lycopersicum