Tomato Marker Database

original sequence
>SL_EcoRI0098D04_SP6_310026 SL_EcoRI0098D04_SP6_310026 Chromat_file:SL_EcoRI_098_D04-SP6 SGN_GSS_ID:326852 (vector and quality trimmed)
GATCCCCGGGTCCGAGCTCGAATTCCCTGGATGATCTACGTCCCTTTTTTTGGCGGGGTT
ATCGGAAACCTCTCTGCCTCCGTACTGTAGGGGTAAGGATGCATATGCACCCATCCTTTG
CAGACGCCACTATGTGGAATTACATCGGGACATGTTGTTGTTGTTTGCAATCTTGATCTA
CGTTCACATGTTTATGAATTGCTGTGTATATACGTAATGAATGTGATTATTGTCATGGGA
TCTTTTTTATTACAGATTCTTGACACTGTTTGATTCTG


MarkerDB | Solanum lycopersicum