Tomato Marker Database

original sequence
>LE_HBa0146D21_SP6_71992 LE_HBa0146D21_SP6_71992 Chromat_file:LE_HBa_146_D21-SP6 SGN_GSS_ID:71992 (vector and quality trimmed)
CCTATTGCATTGCGAGGTTTAACCGTGAGAACTATAAACATCCTTAAAATAATAACAACA
AAAAGACATAAAATTATAGTTAACTAATCAAGCAAAAATATTTAATATATTTAGTTATAT
ATAATTTGAAGAGGAAAGAAGTATCGTGTTCTCAACATAACATAATTTAATTCTTCAAAA
TTTAAAAAGTGAATAAAAACAATCAGTGTCTTTAGAAACTACAAAAATAAGAAAAATAAT
CTCAAAAAACTACAAAAAGAAGCAAAAGAGAAAATGAACAAATTATTTTTTTTATAAAGA
AAAGCGTAACTTACATAAATAGCTATAATTTTTGGGTTATTAGATTGAAATAACTATAAG
TATCAAATTTAAAAATAATAGCTACACTTTGTGTTATAAAATGGCTATATCCATATATGT
GCTGTTTTTTATAATACAAAAATATATTCTAATTAATTTTCCACTAAGTAAGGTAAATTA
GTTAAAGTAACTGACAAGGCTTTTTTACATACCTTAAACCCACTAATTTGGCACTTTAAG
TATATAATGACCACTACGTGTTAGGATTTTTATCAGTTTAAAAATAATAATTATGTACGT
TCTTTCTTATTCAATTGACGCCTATGAAAAATACAATTCAATGGTTACCATCACAGTTTT
GATC


MarkerDB | Solanum lycopersicum