Tomato Marker Database

original sequence
>LE_HBa0068H23_SP6_66812 LE_HBa0068H23_SP6_66812 Chromat_file:LE_HBa_068_H23-SP6 SGN_GSS_ID:66812 (vector and quality trimmed)
GTTTCTTTTATTCTTTGATTAATGTTGATGTCTAGTGATAGACTGTTTGCTTTTAAACCG
AGTGCGTCTGAGTTGTTGGAGGTATAATCTATTTTCTTGTGTTTGTTGTTGTTTTGTTTG
TTAAAGATGTGCCTTCAATCAGTAGTTCCATCGAATTTTTTTGTCATTTATGTTTTAGGA
GTTATCTATCGATTTTATTTAACTATCTGATGATACTAATTCTGATTATGAGTACAGAGG
ATGTTAGCTGCTGTTGCCTATTTCAAAAATTTGAAGTGTTCCCGTAAAATCTTTATTTAG
TTACTGACGTGTTGATTTCTGGGTGTTTTAAAACCAATTAACTTGTTCGTTTCTTGTAAA
CATTGCTGCTACAAACAAATAAAAATTGCCTTATATGCACTAACTAACTAATTTAAAGTG
TTCCCAAAAATTTCTATGTTGGTTTCTAAAGACTGCATCTGTTCCAACTTTTGTTTCCGC
ATATCTTCAATTCTCTCACCCTTATAGTTGTATTTCGTTAGTATAGAAGTTGTACTTGTG
TGATTGCATACCAA


MarkerDB | Solanum lycopersicum