Tomato Marker Database

original sequence
>LE_HBa0166J10_T7_78403 LE_HBa0166J10_T7_78403 Chromat_file:LE_HBa_166_J10-T7 SGN_GSS_ID:78403 (vector and quality trimmed)
AGCTTTAAACAACTTTTTAATAACCTAACACATTAGCGGAAAATAAAGTGAAATAAAAAA
AATATATATATATATATACATATATATATCTATACACACACACACACACACATACCATAT
TTTTTCTTTTTAAAATTTTGTTTAAATAGAAATGTTTGTGCCGAGAACAGGCCAGGTAAT
ATCATTCACATTCATCTCCAGCATAGCGGACACTATATTTTTAACATATTTCCACTCTAT
AGGTCAAATAAACCATTAGTTTGATACAATGTCTTAATTTTTTCCTTTGTCTATCTGAAA
GCTAGATCATATCATAAGCACTATATACGATTAATAAGCTCTATCGTTGGAACCTATTAA
ATACATTCTCCTTGCCCATTCATGAAATTAAATTTAATATTGTATATATTTGATGAGTTT
CCTAACATTTAGCATGGCTTAGTCAAAAACCCATATTTAAAGTCAGTACGAATTTTTTTA
TCATTTCACTAAGCTAACAAGTTCTTCTATAATGTTGAGTGTGTATTGTTATATTGTAAA
TTTTCCTTTTAGGCAGATCAATGGAACTACGGTTGGCAAGCTATAGAGTGCTCAAAATAA
TGAACCTCTCATGAACCCACCCCTTCCCTTACCTATTAATTATTTTATAATATTATCTAC
GTCCCGCCCTGGCCTACTCTGCGCTAACCCATT


MarkerDB | Solanum lycopersicum