Tomato Marker Database

original sequence
>Contig13757 Contig13757
GCTGCTTCTTCTTCTCTCCTCCATTTTCTTCCCAAACATGTTTTGAATATCTTTGTTTGC
TTCCTCCAACAAAATAAAGCTCAGTACGCACAAGCTTTCGGCTTCTCTGTTTCAGAATAG
AAACAGCCACATCAACGAGAAGATTTACCAAGAAAAAAGCTTCAATGGAGTTACTGAACC
CGAACTTGCCTCATGGTGCTAACATTGGCGGTGACATCTCGTTGATGCTTGAGCTTCCAG
AAAATGACAGGTTCTTCAAGAAAAAGAAGAAACTGCTGGAAGACATGGGTTCTCATGCCA
AACATACATCCATACATAGCTTTGCAAGTCCTGGTGAAGTTGAGTCTTCTTTACTTTTGA
TGCTTGAGAGAGCTAGAATCATAAACTTAGATGAGCTGGAACTTTACTTTGGTGGCGAAG
ATGTCAAGGACATGGTAGGCTTTAATAGTCCAAGGAATGAGATGGAAGCCTTGAATTCAA
TTCTTACAGCCATTGCTAAGTTGGACGGAGAACATTGTTCAACCACCACATTGGAAGAAT
TACGAGTTGCAGCTGTCAACTTGATTTCTGAATTGGGAAAGAAATGTAAAGAGGAGAGCA
AAGTTGTTACTCGGTCTAGCTGTGAGGCAGAGAAATGTTTACAACAGTGGGGCGAAGACC
AAGGTGTGAAGTCACAATTGGAGATATCTTACTTTGAAGGAGCTGGAAGGGGAGCCATTG
CAAGACAAGATCTGAGAATTGGAGACATTGCCTTGGAGATCCCTTTATCCATTGTCATTT
CAGATGATCTTGTGCATGAATATTACATGTATTCCATTTTGGAAAAGATCGAGGGCATGT
CAGCAGAAACAATGTTACTGTTGTGGAGCATGAAGGAGAAGCACAACCCTGATTCCAAAT
TTAAGTTGTACTTTGATACGCTGCCAGAGGTATTTAATACAGGTTTGAGTTTTGGAATGG
AGGCTATAATGGCTTTAGATGGAACCTTGCTGCTAGAAGAGATTGTCCAAGCAAAAGAGC
ACTTGCGTGCACAATATGATGAACTATTTCCATCCCTATGCAATGATCACCCAGATGTAT
TTCCTCCGGAGCAATACGGATGGGAGCAGTTCTTATGGGCTTGTGAACTTTGGTACTCCA
ATAGCATGAAAATTATGTTTACTGATGGAAAGCTAAGAACCTGCTTGATTCCAATTGCAG
GTTTTCTTAATCATTCGACTTGTCCACACATAATGCACTATGGGAAAGTTGATTCCACGA
CAAATTCTATAAAATTTCCTTTGTCAAGGTCGTGTAATGCAGGGCAACAATGTTTTCTTG
GCTACGGGAGCTTCTCTAGTTCTCATCTACTGACCTTCTATGGTTTTCTACCACAACTAG
ATAACTACTATGATGTGATTCCGCTAGATATTGATGTTGCAAGCAATGATGATTGTGCAG
ACACAGACCCTACACCTGATTGGACCTCCCATATGGTCCGTGGAACTTGGTTCTCAAAGA
ATCACGGCATCTTCCATTATGGGTTACCAGCGCCTCTACTGGATCGTATGCGTAGATCTC
GGAATCCTTCCTTGCAGTCGATGACCCTTACACCAGAGAACTTAGAAATTGAACTCGACA
TACTTAAGGACCTTTGTTCTATGTTCGAAGAGATGCGGGATGGACTAGGAGATCCTGAAT
TGGATAACAGGGAGACCACAAGTTGTGATGTAAAGC


MarkerDB | Solanum lycopersicum