Tomato Marker Database

original sequence
>Singlet2240 Singlet2240
TGCGCTGTATTTGTCCCTTAATTATCTTGGATTGAGGGACCTTCTCTCTGTTGAGGGTGT
TTGCAAAGCTTTAAGAGATGTGGTGCGTAGCGATCCACTTCTGTGGAGAGATATTCAAGT
TGATTATCCGTTGAGTAATAAGATCACAGATGATGTTCTTATAAAGTTGACGGACAGGGC
TCAAGGTCATCTTGATTCTGTGTGTCTTATGCACTGCCCAAGGATTACTGATAGTAGTTT
GAATTGTGTGCTTGAAAGGAATTCTAGCCTGAAAAAGCTTAGTGTCCCGGGATGTGTGAG
ACTCACAGCTGATGGTATTCTCCGGAACTTAAAGGTCTTACGGTCTGCAGGTAAACCCAG
ACTTAAGTACCTTGGGGTCAATGGATTATTTGGTATGACACACCACCACTTTGAAGAGTT
CAAGGTCTTGTTAGGTGTTGACAGCAGCAAGCTGCCATCTACTCGTAAACCACGGTTTCT
CCAAGGTGGACAGTTATCTGTGTCTTCTGATGATGATTATGCTATTGATATTGAAATATG
CCCGATATGCCAGCAGCTTAGAGTAGTCTATGATTGCCCCTCAGAAAGTTGCGAAAAGAA
GAAATCTACTGCTCAGTCGTGCAGAGCTTGTACTATCTGCATTAAACGTTGTATTCACTG
TGGGGCGG


MarkerDB | Solanum lycopersicum