Tomato Marker Database

original sequence
>Singlet1499 Singlet1499
TTTATGATGCCTGATCTATTTGAAACAGGAGATGTTGACTTGAAAAAACTATTGAATGCA
GAAGATAAAGAGTTAATTGCTCGAATAAAGTCCATTCTTGGACCTTTCATTTTGAGAAGA
TTAAAATCGGATGTGATGAAACAACTGGTACCAAAAATACAGACGGTTCGTTATGTCGGC
ATGGAGAAACAGCAAGAAGATGCATATAAAGAAGCGATTGAAAGCTACCGTGCTGCATCT
CTAGCTCGTGTTTCAAAGCAACCTGTTAGTTTGACTAATGCTGCTGGTGTCTTTTCGAGA
CGACAAATTTCCAATTATTTTCTTGAATTCCGCAAGATTGCAAACCATCCTCTGCTTGTG
AGGCGTATTTATACAGATGATGATGTTGTTCGAATTGCTAGAGTTGTGCATCCCAAAGGT
GTCTTTGGTTTTGAATGTACAGTGGACAGAGTAATTGAGGAGCTGAAGAGCTACAATGAC
TTCTCCATCCACAAGCTTTTACTTTACTATGGTGATAATAATAAGGGAGTGCTGTCAGAT
GAGCGTGTTATGATTTCAGCTAAATGTCAAGAATTAGCCAAACTTCTCCCTTCATTAAAC
CTTTCTGGTCATCGAGTGCTTATTTTTAGCCAGTGGACATCAATGCTTGATATCCTGGAG
TGGACCCTAGATGTTATAGGTGTTACATAC


MarkerDB | Solanum lycopersicum