Tomato Marker Database

original sequence
>Contig31 Contig31
GGCACGAGCCCAGGGCTCCTGTATTATTATTACAACATAATGATAAGATCAACAGCAAAG
CACAGTTTCGCAAAACCCATCATTCTTCTTCTTGCATTTGTTGCTCTTCTAGCAATTTCC
TTGACCCGCGATTTTCATTCCGCTTCTTCTTCTGCTTATGTTTCCCTTGCTACCACTTGG
GCTCCTGACAAGTACCGTATTAATGTCTCCAATCAGAATCAGGATGTAGGAGGAGGAAGT
AATAAGGATCGTTACCCTGAGAGAGCGTTATCCATGACCTATGCTGATTTGCCTGCTCCT
GAATTGAAATGGGAACAGATGGCATCTGCACCTGTGGTTCGTTTGGATGGCTATTCTCTT
CAGATTAAAGATTTGCTTTTCGTTTTTGCAGGATATGAAAACCTAGACCATGTGCATTCT
CATGTTGATGTTTACAATTTTACA


MarkerDB | Solanum lycopersicum