Tomato Marker Database

original sequence
>Contig14426 Contig14426
GAAACAAACCAAGACAAGAAAGCAAACAAAATGGATAGAAGAATACTTGGTTTGTCTGTC
CTAACACTCATGATTTGCTCTCTCCTTGTAACAAAAACATGGGCCGATGAAGATAAAAAC
CCAGAAGAAGCAGCCGCGGCTGCTAATCAGAACTCGGAACCAGCAGCAGCAGCAGCAGCT
GTTGGAGCTACTCCAAAAGAACCAAAGAGCGATGATTCTGATGCACATGATAGTGATGAG
AATTACGTTGTTCCGGATGGTTTTAATGGGAAAGAAGATCAATTTAGTCCTGAAATCATC
GTTGTTGGGCATTAAGTTAATTAATTAATTAGTCCTTTTTCATCAGTGTCATATTTCATG
ACTTAAATATGACATGTTTACATTCATGTTTTTTGCAAATTTTTGAATGAACATATAATA
AATGACAATTTTAAACAATTGTACGTGTGCTTTCTTTGTTATTTGTTGTTGGGCATTAAG
TTAATTAACATTAGAGTACATTTGCAAATTTCCGTATGAACTTATAATAAATTACAATTG
GAAAC


MarkerDB | Solanum lycopersicum