Tomato Marker Database

original sequence
> SNP sequence
TAACTTAAAAGGGAGCAACCCATCTCCTGAAAACGATAGCTCAAAAAATACTGGATCTCC
[G/A]AAAGCTCATCAGAAGCCCTTGGACTGGAGGGAATTCCGAGCATCTCTTTACATTC
AGGA


MarkerDB | Solanum lycopersicum