Tomato Marker Database

original sequence
> SNP sequence
AAGTCATGCTNTGAAGTTTGTGGATTTTGTCAGTAGGATGGTACTTGTTAGGACCCGAAA
[C/T]GCCAAGCAACTCGCNTCTCATGATCATAAGAGCAATATCGTCAATTATAAGTACA
CATT


MarkerDB | Solanum lycopersicum