Tomato Marker Database

TGS5723 Information

Marker name TGS5723
Marker category Genome-SSR
Primer sequences Fw GTGCATTGCACAAGTGGACTC
Rv AAGAAAACCCATTTAGCACCC
EST/Genome sequences LE_HBa0087J02_SP6_24626
SSR Fragment size 175
Pattern* AT(mis2)
Repeat count 8
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum