Tomato Marker Database

TGS5512 Information

Marker name TGS5512
Marker category Genome-SSR
Primer sequences Fw GTGAAAATGGAGGAAAATCCG
Rv TCACTCCCTCAACCTCTTCC
EST/Genome sequences LE_HBa0011M23_T7_5686
SSR Fragment size 203
Pattern* AAAT(mis2)
Repeat count 4
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum