Tomato Marker Database

TGS5388 Information

Marker name TGS5388
Marker category Genome-SSR
Primer sequences Fw GAAACAAATCTTTATCAGATATTTTCCA
Rv AACACCTTTGGTGCATCGTT
EST/Genome sequences LE_HBa0226E14_T7_385927
SSR Fragment size 287
Pattern* AC(mis2)
Repeat count 9
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum