Tomato Marker Database

TGS5342 Information

Marker name TGS5342
Marker category Genome-SSR
Primer sequences Fw GCATGAAGGCCATGTTTTTCC
Rv AAACCAAACTGAATGGACGC
EST/Genome sequences SL_MboI0139B24_T7_361379
SSR Fragment size 183
Pattern* AAT(mis2)
Repeat count 6
Comments

* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.


MarkerDB | Solanum lycopersicum