| Marker name | TGS3413 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TTTCTTGCATTCTTTCCCCA | |
| Rv | GGTCACGTTCTTGAGTGCAA | ||
| EST/Genome sequences | SL_EcoRI0041O02_SP6_243525 | ||
| Map | Expen2000 | Linkage | ch02 |
| Position | 107.565 | ||
| SSR | Fragment size | 90 | |
| Pattern* | AAT(mis1) | ||
| Repeat count | 5 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.