Marker name | TGS3071 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | CACATTCGAATAAATAAAATAGCG | |
Rv | GCTCTTCTTCGCTACCTTGC | ||
EST/Genome sequences | SL_MboI0089H10_T7_181976 | ||
Map | Expen2000 | Linkage | ch11 |
Position | 66.475 | ||
AMF2 | Linkage | ch11 | |
Position | 71.405 | ||
SSR | Fragment size | 229 | |
Pattern* | AAAT(mis1) | ||
Repeat count | 4 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.