Marker name | TGS2757 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTGGCCTAATTTCTTTACGAACG | |
Rv | CACACACACACACACACACTCA | ||
EST/Genome sequences | SL_MboI0028M20_T7_267141 | ||
Map | AMF2 | Linkage | ch11 |
Position | 57.131 | ||
SSR | Fragment size | 273 | |
Pattern* | AT(mis1) | ||
Repeat count | 9 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.