| Marker name | TGS2390 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GTTTTTAAAGGTCAACGGCAAA | |
| Rv | CGATCACGGCTTTGAAAACT | ||
| EST/Genome sequences | SL_EcoRI0068C01_SP6_339924 | ||
| Map | AMF2 | Linkage | ch09 |
| Position | 8.593 | ||
| SSR | Fragment size | 259 | |
| Pattern* | AT(mis1) | ||
| Repeat count | 10 | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.