| Marker name | TGS2379 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GTGAACATGTTTTTGTGCGAGA | |
| Rv | CCCAATATGGTGGCCAAAG | ||
| EST/Genome sequences | SL_EcoRI0117E06_T7_324671 | ||
| Map | Expen2000 | Linkage | ch04 |
| Position | 31.331 | ||
| SSR | Fragment size | 108 | |
| Pattern* | AC(mis1) | ||
| Repeat count | 10 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.