Marker name | TGS2205 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GGGCCTAACACCATCTCAAA | |
Rv | CGTGCATTGAATTACCGATG | ||
EST/Genome sequences | LE_HBa0021K09_SP6_79984 | ||
Map | AMF2 | Linkage | ch07 |
Position | 12.016 | ||
SSR | Fragment size | 188 | |
Pattern* | AC(mis1) | ||
Repeat count | 10 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.