Marker name | TGS2103 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GCCACCAGAAGCAAGACCAAT | |
Rv | ATCACATTTTGTGAAGCCCC | ||
EST/Genome sequences | SL_EcoRI0077O09_T7_346661 | ||
Map | Expen2000 | Linkage | ch11 |
Position | 62.004 | ||
SSR | Fragment size | 221 | |
Pattern* | GGT(mis1) | ||
Repeat count | 7 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.