Marker name | TGS1835 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GAACCTTCATGGCACACCTTT | |
Rv | CTTGAATTGGATTGCATTGA | ||
EST/Genome sequences | SL_EcoRI0035D20_T7_295201 | ||
Map | AMF2 | Linkage | ch02 |
Position | 22.933 | ||
SSR | Fragment size | 286 | |
Pattern* | AT(mis1) | ||
Repeat count | 11 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.