Marker name | TGS1475 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GCGTGCAAACACACTCTCAT | |
Rv | ACCCGAGTTCAATATGGACG | ||
EST/Genome sequences | LE_HBa0092F16_SP6_26766 | ||
Map | AMF2 | Linkage | ch03 |
Position | 51.975 | ||
SSR | Fragment size | 259 | |
Pattern* | AC(mis1) | ||
Repeat count | 31 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.