Marker name | TGS1399 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTTCCTTTTGTGCCAATTTGA | |
Rv | ATAATCACACACGCACGCAT | ||
EST/Genome sequences | SL_MboI0135G21_SP6_382012 | ||
Map | AMF2 | Linkage | ch03 |
Position | 52.855 | ||
SSR | Fragment size | 295 | |
Pattern* | AT | ||
Repeat count | 10 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.