Marker name | TGS1349 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GCATTGGAGACAACAGCAGA | |
Rv | AAAAACTACCCAAACGTGCG | ||
EST/Genome sequences | LE_HBa0115F02_T7_39027 | ||
Map | Expen2000 | Linkage | ch10 |
Position | 39.559 | ||
SSR | Fragment size | 197 | |
Pattern* | GGGA | ||
Repeat count | 5 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.