Marker name | TGS1266 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | TGCAGAGCACAGAAAAGAAAAA | |
Rv | GTAGCACTGCCAGTCGTCAA | ||
EST/Genome sequences | LE_HBa0091M07_T7_95437 | ||
Map | AMF2 | Linkage | ch04 |
Position | 66.429 | ||
SSR | Fragment size | 225 | |
Pattern* | ACT | ||
Repeat count | 7 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.