Marker name | TGS0891 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTGGAAACTATGGCCTTCCAC | |
Rv | TGGTTGAAAGAAGTGGACAAAA | ||
EST/Genome sequences | SL_EcoRI0068A21_T7_339869 | ||
Map | AMF2 | Linkage | ch08 |
Position | 112.178 | ||
SSR | Fragment size | 263 | |
Pattern* | AC | ||
Repeat count | 13 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.