| Marker name | TGS0874 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TAGGCAAAAAGACGGGCTAA | |
| Rv | GTTTCCTTCGTGGTGCTGTT | ||
| EST/Genome sequences | LE_HBa0187L18_SP6_278726 | ||
| Map | AMF2 | Linkage | ch05 |
| Position | 40.303 | ||
| SSR | Fragment size | 169 | |
| Pattern* | AT | ||
| Repeat count | 13 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.