Marker name | TGS0749 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTCTGTATGCGCGTGTGTGTA | |
Rv | ATCCATGCTGCCTGAAAAAC | ||
EST/Genome sequences | SL_EcoRI0100A09_SP6_311428 | ||
Map | Expen2000 | Linkage | ch03 |
Position | 58.188 | ||
AMF2 | Linkage | ch03 | |
Position | 47.348 | ||
SSR | Fragment size | 202 | |
Pattern* | AT | ||
Repeat count | 14 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.