Marker name | TGS0610 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTTAGTGAAGTGAAGAGGAAGCAA | |
Rv | CCGGCAAGCTGCATTTTT | ||
EST/Genome sequences | SL_EcoRI0095E18_T7_358103 | ||
Map | Expen2000 | Linkage | ch08 |
Position | 27.795 | ||
SSR | Fragment size | 209 | |
Pattern* | AT | ||
Repeat count | 16 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.