| Marker name | TGS0501 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GCCTTTTGTGGGTGCAATTTT | |
| Rv | TGGATGTGGTGATTCAATCTG | ||
| EST/Genome sequences | SL_MboI0099N04_T7_188780 | ||
| Map | Expen2000 | Linkage | ch07 |
| Position | 0.674 | ||
| AMF2 | Linkage | ch07 | |
| Position | 10.913 | ||
| SSR | Fragment size | 247 | |
| Pattern* | AT | ||
| Repeat count | 17 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.