Marker name | TGS0486 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTGTGGAATTAATTTAAGGTCGAG | |
Rv | TTGAGTAAGTCCACATATTGCG | ||
EST/Genome sequences | LE_HBa0186M16_T7_66271 | ||
Map | Expen2000 | Linkage | ch01 |
Position | 71.81 | ||
AMF2 | Linkage | ch01 | |
Position | 113.997 | ||
SSR | Fragment size | 257 | |
Pattern* | AT | ||
Repeat count | 17 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.