| Marker name | TGS0412 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GTTACCCGGATTCCCATGATA | |
| Rv | TGGGATTCAAACCAGTGACA | ||
| EST/Genome sequences | SL_EcoRI0065I09_SP6_299703 | ||
| Map | Expen2000 | Linkage | ch07 |
| Position | 53.716 | ||
| SSR | Fragment size | 115 | |
| Pattern* | AT | ||
| Repeat count | 19 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.