| Marker name | TGS0361 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TGAAAGGTCAAGATTGTGAAATG | |
| Rv | GAGCCTTGGTGGAAGCAAT | ||
| EST/Genome sequences | SL_EcoRI0051K05_T7_245138 | ||
| Map | AMF2 | Linkage | ch02 |
| Position | 15.685 | ||
| SSR | Fragment size | 265 | |
| Pattern* | AT | ||
| Repeat count | 20 | ||
| Comments | |||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.