| Marker name | TGS0334 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | TTGCAGCTTCTTGGTTTCCT | |
| Rv | GTGGCCTTTTCTTGTTCGTG | ||
| EST/Genome sequences | SL_EcoRI0007P20_T7_304579 | ||
| SSR | Fragment size | 269 | |
| Pattern* | AAT | ||
| Repeat count | 14 | ||
| Comments | NIVTS Ohyama et al. 2009 http://vegmarks.nivot.affrc.go.jp/ |
||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.