| Marker name | TGS0239 | ||
|---|---|---|---|
| Marker category | Genome-SSR | ||
| Primer sequences | Fw | GCGAGGCAATAATCGAACACA | |
| Rv | TGTCTGTCTCAACCTCTAGCCA | ||
| EST/Genome sequences | SL_MboI0070C09_SP6_285721 | ||
| Map | Expen2000 | Linkage | ch01 |
| Position | 30.687 | ||
| SSR | Fragment size | 116 | |
| Pattern* | AC | ||
| Repeat count | 24 | ||
| Comments | KDRI | ||
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.