Marker name | TGS0232 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTCGGGTTGAGTTAGGCTCAG | |
Rv | AAAGTGAAAGGGTGGAGGATT | ||
EST/Genome sequences | SL_MboI0086E20_T7_165421 | ||
Map | Expen2000 | Linkage | ch05 |
Position | 75.004 | ||
SSR | Fragment size | 216 | |
Pattern* | AT | ||
Repeat count | 24 | ||
Comments | KDRI |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.