Marker name | TGS0121 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GCTATGTTGGCGGCATAGGTT | |
Rv | TCGCTTATACCTTAAAGAGGGTC | ||
EST/Genome sequences | SL_EcoRI0088A19_T7_353689 | ||
Map | AMF2 | Linkage | ch11 |
Position | 57.799 | ||
SSR | Fragment size | 157 | |
Pattern* | AT | ||
Repeat count | 29 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.