Marker name | TGS0047 | ||
---|---|---|---|
Marker category | Genome-SSR | ||
Primer sequences | Fw | GTTGGAGTGCAATATTTGGGT | |
Rv | TTCGCTTAGGACAAGAATGACTT | ||
EST/Genome sequences | SL_EcoRI0061F15_SP6_256241 | ||
Map | AMF2 | Linkage | ch09 |
Position | 112.879 | ||
SSR | Fragment size | 233 | |
Pattern* | AT | ||
Repeat count | 36 | ||
Comments |
* "mis1" and "mis2" in parenthesis indicate imperfect SSR motifs having 1- and 2-base mismatches in the SSR regions, respectively. Perfect SSR motifs have no descriptions.